circad | circRNAs associated with diseases

hsa_circ_002082
Gene	MTG1	Organism	Human
Genome Locus	chr10:135209216:135216277:+	Build	hg19
Disease	Hepatic Steatosis	ICD-10	Fatty (change of) liver, not elsewhere classified (K76.0)
DBLink	Link to database	PMID	28717649
Experimental Method
Sample Type	HepG2 cells	Comparison	model and control HepG2 cells
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCAGCTGAGTGATAAAGGCTGA Reverse TCGTTCTTCCGCTCAAATCCT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Guo, XY, He, CX, Wang, YQ, Sun, C, Li, GM, Su, Q, Pan, Q, Fan, JG (2017). Circular RNA Profiling and Bioinformatic Modeling Identify Its Regulatory Role in Hepatic Steatosis. Biomed Res Int, 2017:5936171.